Open Access

Mesencephalic astrocyte-derived neurotrophic factor reduces cell apoptosis via upregulating HSP70 in SHSY-5Y cells

  • Hui Sun1,
  • Ming Jiang2, 3,
  • Xing Fu3,
  • Qiong Cai1,
  • Jingxing Zhang1,
  • Yanxin Yin3,
  • Jia Guo3,
  • Lihua Yu3,
  • Yun Jiang3,
  • Yigang Liu1,
  • Liang Feng1,
  • Zhiyu Nie1,
  • Jianmin Fang2Email author and
  • Lingjing Jin1Email author
Contributed equally
Translational Neurodegeneration20176:12

https://doi.org/10.1186/s40035-017-0082-8

Received: 27 December 2016

Accepted: 3 May 2017

Published: 22 May 2017

Abstract

Background

Mesencephalic astrocyte-derived neurotrophic factor (MANF) is a new candidate growth factor for dopaminergic neurons against endoplasmic reticulum stress (ER stress). HSP70 family, a chaperon like heat shock protein family, was proved to be involved in the MANF induced survival pathway in 6-OHDA treated SHSY-5Y cells. However, the ER stress relative transcriptome, in MANF signaling cascades is still investigated. The involvement of HSP70, a 70kd member of HSP70 family, need further to be verified.

Methods

The cell apoptosis was assayed by MTT, TUNEL staining and western blot of cleaved Caspase-3. The differentially expressed genes in SHSY-5Y cells under different conditions (control, 6-OHDA, 6-OHDA + MANF) were investigated by RNA-seq. Expression of HSP70 was further confirmed by real-time PCR. RNAi knockdown for HSP70 was performed to investigate the role of HSP70 in the MANF signaling pathway.

Results

MANF inhibits 6-OHDA-induced apoptosis in SHSY-5Y cells. Six ER stress relative genes (HSP70, GRP78, xbp-1, ATF-4, ATF-6, MAPK) were found enriched in 6-OHDA + MANF treatment group. HSP70 was the most significantly up-regulated gene under 6-OHDA + MANF treatment in SHSY-5Y cells. RNAi knockdown for HSP70 inhibits the protective effects of MANF against 6-OHDA toxicity in SHSY-5Y cells.

Conclusion

MANF exerts a protective role against 6-OHDA induced apoptosis in SHSY-5Y cells via up-regulating some ER stress genes, including HSP70 family members. The HSP70 expression level plays a key role in MANF-mediated survival pathway.

Keywords

HSP70 MANF Parkinson’s disease SHSY-5Y cell

Background

Parkinson’s disease (PD) is one of the most common neurodegenerative disorders of the central nervous system. It is characterized by chronic and progressive loss of midbrain dopaminergic (DA) neurons. Over the past years, the precise etiology and disease pathogenesis are mostly unknown. Current therapy strategies aim at symptomatic relief rather than preventing disease progression. The use of neurotrophic factors represents a potential treatment strategy, which is essential to neuronal differentiation and maturation during development and adulthood.

The newest candidate growth factor for dopaminergic neurons is mesencephalic astrocyte-derived neurotrophic factor (MANF), a kind of evolutionarily conserved neurotrophic factor. It was described few years ago as a survival promoting factor for embryonic midbrain dopaminergic neurons in vitro [1]. The protective effect of MANF is specific for dopaminergic neurons, and no effects on GABAergic or serotonergic neurons are detected [1].

Some studies have shown that MANF selectively protects dopaminergic neurons by inhibiting the neurotoxicity induced by unfolded protein response(UPR) [2, 3]. Additionally, MANF has been shown to regulate the endoplasmic reticulum stress (ER stress) induced gene transcription, such as HSP70 family, ATF family, xbp-1 and MAPK [46]. In our previous studies, we found that the expression level of HSP70 family, which is considered as a chaperon like heat shock protein family, play key roles in neuroprotection process. In SHSY-5Y cells treated with 6-OHDA or overexpressed α-synuclein, the expression of GRP78, a 78kd member of HSP70 family, is up-regulated under the treatment of MANF [7]. In PC12 cell line, the transcription level and protein level of HSP70 is up-regulated under 6-OHDA treatment [8]. GRP78 and HSP70 share a high degree of homology with HSP70 family [9]. They are considered to be involved in the survival pathway after ER stress [10]. Whether HSP70 is also involved in MANF signaling pathway is still unknown.

RNA sequencing (RNA-seq) is an unbiased sequencing tool that allows transcriptome profiling to detect gene expression changes in a cell or tissue sample. In this study, we aim to comprehensively investigate the expression level of ER stress relative genes in response to MANF treatment. For in vitro study, a DA neurons like cell line, SHSY-5Y cells [11], was employed and cell apoptosis was detected to verify the function of HSP70, which was found significantly changed in the transcriptome in response to MANF treatment. And we also found that MANF/HSP70 is 6-OHDA specific. Hydrogen peroxide solution (H2O2), tunicamycin (TM) and thapsigargin (TG) have been used as normal models for ER stress induced apoptosis. In TM, TG and H2O2-induced ER stress, the expression of HSP70 was not changed under MANF treatment.

Methods

SHSY-5Y cell culture

The human neuroblastoma cell line, SHSY-5Y, was cultured in DMEM/F-12 medium (life technologies, Carlsbad, CA, USA) containing L-Glutamine 300 mg/L, 10%FBS (fetal bovine serum) and kept at 37 °C in a humidified 5% CO2 incubator. 150 μM 6-OHDA (Sigma, St.Louis, MO) was used to induce apoptosis, leading to 50% reduction of viability after 24 h as measured with MTT assay.

RNA-Seq

SHSY-5Y cells were harvested and total RNA was extracted using the TRIzol (Life Technologies) method. mRNA was further enriched from the total RNA using oligo dT magnetic beads (Life Technologies). Then, the mRNA was fragmented into short fragments (200–500 bp) using an RNA fragmentation kit (Ambion, Austin, TX). First strand cDNA was synthesized by random primers, followed by the synthesis of second strand cDNA. Double stranded cDNA was purified using a QIAquick PCR extraction kit (Qiagen, Hilden, Germany) and used for end repair and base A addition. For high throughput sequencing library constructed according to the manufacture’s instructions of BGI-Shenzhen (Beijing Genomics Institute, Shenzhen, China). Paired-end sequence reads were generated utilizing an illumina HiSeq 2000 instrument with TruSeq v3 reagents at BGI-Shenzhen.

RNA Seq data analyses

For RNA Seq sequence reads, one base was trimmed from the 5’end and then the reads aligned to the human genome (hsa, NCBI) and transcriptome using TopHat [12]. The Refseq gene annotation file was provided for TopHat using the default parameters. Only uniquely and properly aligned read pairs were used for downstream analysis. The Cuffdiff program was used to calculate the relative abundance of each gene. A gene was defined to be differentially expressed with statistical significance if it met either of the following conditions: the fragments per kilobase of exon model per million fragments mapped (FPKM) value was zero in one sample and not less than 0.05 in the other, or the q-value calculated by Cuffdiff was less than 0.05. Gene ontology (GO) analysis was performed using the online program DAVID.

Quantitative real-time PCR

To analyze HSP70 transcription by quantitative real-time PCR (qPCR), total RNA was extracted as described above and reverse-transcribed to cDNA using oligo-dT primer and Superscript II reverse transcriptase (Invitrogen, Darmstadt). The genetic expression of HSP70 was normalized to the internal reference control gene, β-actin. The following primer pairs were used: β-actin, forward primer: 5′- CCCAGATCATGTTTGAGACCT-3′ and reverse primer: 5′- CAGAGGCGTACAGGGATAGC-3′; human HSP70, forward primer: 5′- TAACCCCATCATCAGCGGAC -3′ and reverse primer: 5′-GAAGCTCCAAAACAAAAACAGCA -3′. human GRP78, forward primer:: 5′- AGACGGGCAAAGATGTCAGG -3’and reverse primer: 5′- GCCCGTTTGGCCTTTTCTAC -3′; human Xbp1, forward primer: 5′- CTGAGTCCGCAGCAGGTG -3’and reverse primer: 5′- TGTCCAGAATGCCCAACAGG -3′; human ATF4, forward primer: 5′- CTTGATGTCCCCCTTCGACC-3′, reverse primer: 5′- CTTGTCGCTGGAGAACCCAT-3′; human ATF6, forward primer: 5′- GAGTATTTTGTCCGCCTGCC -3′; reverse primer: 5′- GGCTCCCCCATTTCACAAGT -3′; human MAPK, forward primer: 5′- CAGGACTGCAGGAACGAGT -3′, Reverse primer: 5′- TTCCTTGTAGCCCATGCCAA -3′; GAPDH, forward primer:5′- GTCAAGGCTGAGAACGGGAA -3′, reverse primer:5′- TCGCCCCACTTGATTTTGGA -3′. The relative gene expression was calculated via the comparative Ct method.

RNAi of HSP70

For hsp70 RNAi knockdown experiment in SH-SY5Y cells, we design the target site of small hairpin RNAs (shRNA) for hsp70 from 3476 to 3494 cDNA (NM_005347). 2 independent shRNAs (shHSP70–3 and shHSP70–4) is as follows. Synthesized shRNA template oligonucleotides were phosphorylated, annealed, and then ligated into linearized PLV-shRNA clotech vector digested with EcoRI/BamHI. SHSY-5Y were transfected with shRNA plasmid by Lipofectamine 3000 reagent (Invitrogen) and then were treated with drugs.

Western blot analysis

Cells were homogenized in RIPA lysis buffer. Lysates were centrifuged at 14,000 rpm for 3 min, and protein concentrations in the supernatant were analyzed using a BCA Protein Quantitation Kit. Proteins (30 μg) were loaded to each lane and separated by electrophoresis on SDS–PAGE gels, followed by transferring to PVDF membranes. Membranes were incubated with 5% BSA for 1 h. Then, membranes were incubated with primary antibodies against hsp70 (4872; Cell Signaling Technology, USA), PERK(MA5–15033, Thermo Fisher, USA),caspase-3 (9579; Cell Signaling Technology, USA), and MANF (H00007873-M01; Abnova, USA), overnight at 4 °C. Membranes were incubated with horseradish-linked secondary antibodies (7074; Cell Signaling Technology, USA) for 2 h at 37 °C. Bands were visualized using an ECL detection system.

TUNEL staining

TUNEL staining was performed according to manufacturer’s protocols. Briefly, cells were washed with PBS three times and fixed in 4% paraformaldehyde in PBS. Cells were treated with 50 μL of TUNEL reaction mixture for 1 h at 37 °C, then washed three times with PBS. Cells were counterstained with DAPI for 5 min and examined under a fluorescence microscope.

Statistical analysis

All results were expressed as mean ± SEM. GraphPad Prism 5.0 software was used for statistical evaluation. Comparisons among different conditions were performed using one-way ANOVA and two-way ANOVA with Bonferroni post-test, and unpaired, two-tailed t test.

Results

6-OHDA has neurotoxic effects on SHSY-5Y cells

To induce excitotoxicity, SHSY-5Y cells were exposed to 6-OHDA in concentrations ranging from 25 to 150 μM for 24 h. A significant reduction in SHSY-5Y cell number was observed following incubation with 75-150 μM 6-OHDA, as determined by MTT assay (Fig. 1).
Fig. 1

Assessment of 6-OHDA-induced toxicity in SHSY-5Y cells. Dose dependent neurotoxic effects of 6-OHDA in SHSY-5Y cells as detected by MTT assay. Values represent mean ± SEM, ***p < 0.001,*p < 0.05. One-way ANOVA

MANF inhibits 6-OHDA-induced apoptosis in SHSY-5Y cells

TUNEL staining significantly increased in SHSY-5Y cells treated with 6-OHDA, compared with control cells (Fig. 2a). Forty-eight hours of MANF (4 μg/ml) treatment significantly inhibited the increase in TUNEL staining induced by 6-OHDA treatment (Fig. 2a). These results suggest that MANF inhibited 6-OHDA-induced cell apoptosis. Cleaved caspase-3 level was significantly increased in SHSY-5Y cells under 6-OHDA treatment, compared with control cells (Fig. 6c). Forty-eight hours of MANF (4 μg) treatment significantly inhibited the increase in cleaved caspase-3 level induced by 6-OHDA (Fig. 6c). These results suggest that MANF inhibited 6-OHDA-induced cell apoptosis.
Fig. 2

MANF inhibited 6-OHDA-induced apoptosis in SHSY-5Y cells. a Representative fluorescent images for DAPI and TUNEL merged images in control group; SHSY-5Y cells treated with 150 μM 6-OHDA; SHSY-5Y cells treated with 150 μM 6-OHDA + 4 μg/mL MANF; b: The treatment of MANF showed a significant protective effect against 6-OHDA toxicity. Values represent means ± SEM, ***p < 0.001, one-way ANOVA with Bonferroni post test

Up-regulation of ER stress relative genes under MANF treatment

To gain insight into the molecular mechanism underlying the protective effect of MANF against 6-OHDA-induced apoptosis, we performed whole transcriptome profiling using RNA-seq. For each condition (control, MANF, 6-OHDA, 6-OHDA + MANF), total RNA was isolated. Then, mRNA was further purified and processed for next-generation sequencing. The difference in the read coverage of gene expression between the 6-OHDA and 6-OHDA + MANF is shown in Fig. 3a. These analyses identified 4763 genes with statistically significant differences in gene expression levels between the two samples; 2027 genes were up-regulated and 2736 were down-regulated in 6-OHDA + MANF group relative to the 6-OHDA group. GO analysis showed that the up-regulated genes in the 6-OHDA + MANF samples were enriched in cellular process (Fig. 3b). Strikingly, two ER stress genes (HSP70, xbp-1) were down-regulated and four ER stress genes (GRP78, ATF4, ATF6, MAPK) were up-regulated under 6-OHDA treatment. Six ER stress relative genes (HSP70, GRP78, xbp-1, ATF-4, ATF-6, MAPK) were found to be enriched in 6-OHDA + MANF treatment group(Fig. 3c、d). HSP70 was the most significantly up-regulated gene under 6-OHDA + MANF treatment in SHSY-5Y cells. The expression of the other ER stress relative genes (SP1, IRE-1, MAPKK, SAPK, jnk-1, CHOP, PERK) was not changed under 6-OHDA + MANF treatment (Fig. 3c). To verify the differential expression of the ER stress genes in 6-OHDA and 6-OHDA + MANF group, qPCR was employed to measure the relative abundance of mRNA. To validate the gene expression data obtained from RNA-seq, reverse transcription-quantitative polymerase chain reaction (RT-PCR) was performed. Six changes were selected based on involvement in the ER stress pathway (HSP70, GRP78, xbp-1, ATF-4, ATF-6 and MAPK). RT-PCR confirmed the significant changes in mRNA expression that was observed by RNA-seq after 24 h of 6-OHDA + MANF treatment (Fig. 3e). Phosphorylated PERK was checked by western blot. The reaction of kinase is short, so it can be seen in 5 min after injury. At the time point of 5 mins, the samples under the treatment of 6-OHDA + MANF, phosphorylated PERK did not increase, indicating the protective effect of MANF (Fig. 3f).
Fig. 3

ER stress genes up-regulated in SHSY-5Y cells under MANF treatment. a Differential gene expression between 6-OHDA treatment group and 6-OHDA + MANF treatment group based on RNA-seq analyses, 2027 genes up-regulated; 2736 genes down-regulated; b: Gene ontology analysis of the top 26 biological processes associated with up regulated gene expression in the 6-OHDA + MANF treatment group relative to 6-OHDA treatment group (ranked by q-value). c, d: RNA-seq with whole gene profiling was performed to detect the differentially expressed genes in 6-OHDA + MANF cultures vs. 6-OHDA cultures in SHSY-5Y cells. These genes including HSP70, GRP78, MAPK, ATF6, ATF4 and xbp-1. e: Real-time PCR quantitation of HSP70, GRP78, xbp-1, ATF-4, ATF-6, MAPK mRNA levels in control, 6-OHDA and 6-OHDA + MANF treatment group (mean ± SEM, n = 5). The relative mRNA expression levels of HSP70, GRP78, xbp-1, ATF-4, ATF-6, MAPK in SHSY-5Y cells were normalized to those of GAPDH. (*p < 0.05; one-way ANOVA with Bonferroni post-tests). f: A representative Westernblot result shows the expression of phosphorylated PERK and PERK in control SHSY-5Y cells, SHSY-5Y cells treated with 250 μM of 6-OHDA; SHSY-5Y cells treated with 4 μg/mL of MANF; and SHSY-5Y cells treated with 250 μM 6-OHDA +4 μg/mL MANF at 5 min

MANF up-regulates HSP70 expression in SHSY-5Y cells treated with 6-OHDA

In the ER stress genes, HSP70 was the most significantly up-regulated gene. We investigated the effect of MANF on HSP70 expressions in SHSY-5Y cells treated with 6-OHDA. HSP70 expression levels did significantly decrease in cells treated with 6-OHDA compared with control cells. MANF treatment resulted in a significant increase in HSP70 expression in 6-OHDA-treated cells (*P < 0.05; Fig. 3d). The observed expression of log2 Ratio (MANF + 6-OHDA/6-OHDA) for HSP70 was significantly increased (fold change = 7.07) in SHSY-5Y cells of 6-OHDA + MANF treatment group. To verify the differential expression of HSP70 in 6-OHDA and 6-OHDA + MANF group, qPCR was employed to measure the relative abundance of HSP70 mRNA. Compared with 6-OHDA group, the SHSY-5Y cells in 6-OHDA + MANF group exhibited 2.15-fold increase in HSP70 transcription, as determined by qPCR (Fig. 3e), which is consistent with the 7.07-fold increase observed by RNA-Seq analysis (Fig. 3c, d). But HSP70 expression did not significantly increase under H2O2 + MANF, TG + MANF and TM + MANF treatment in SHSY-5Y cells than in control cells (Fig. 4).
Fig. 4

MANF did not upregulate HSP70 expression levels under H2O2 TG and TM treatment in SHSY-5Y cells. a Real-time PCR quantitation of HSP70 mRNA levels in control, H2O2 and H2O2 + MANF treatment group (mean ± SEM, n = 5). The relative mRNA expression levels of HSP70 in SHSY-5Y cells were normalized to those of β-actin. b Real-time PCR quantitation of HSP70 mRNA levels in control, TG and TG + MANF treatment group (mean ± SEM, n = 5). c Real-time PCR quantitation of HSP70 mRNA levels in control, TM and TM + MANF treatment group (mean ± SEM, n = 5). d Real-time PCR quantitation of HSP70 mRNA levels in control, 6-OHDA and 6-OHDA + MANF treatment group (mean ± SEM, n = 5). The relative mRNA expression levels of HSP70 in SHSY-5Y cells were normalized to those of β-actin

RNAi knockdown for HSP70 abolishes the MANF protective effect against 6-OHDA-induced apoptosis in SHSY-5Y cells

Several lines of evidence have shown that HSP70 protects cells from 6-OHDA-induced cell apoptosis. We showed that RNAi knockdown for HSP70 could block MANF-induced survival of SHSY-5Y cells. These results suggest that HSP70 inhibited 6-OHDA-induced apoptosis in SHSY-5Y cells (Fig. 5a). Similarly, TUNEL staining induced by 6-OHDA treatment did not decrease under MANF treatment in HSP70 RNAi SHSY-5Y cells (Fig. 5b, c). In parallel with this result, we found that in HSP70 RNAi SHSY-5Y cells, MANF (4 μg) treatment did not significantly inhibit the increase in cleaved caspase-3 level induced by 6-OHDA (Fig. 6c). And two independent shRNAs (shHSP70–3 and shHSP70–4) were knocked down and knocking down efficiency was 0.32 and 0.22. We found that in both shHSP70–3 and shHSP70–4 RNAi SHSY-5Y cells, the protective effect of MANF against 6-OHDA induced apoptosis disappeared. TUNEL staining induced by 6-OHDA treatment did not decrease under MANF treatment in shHSP70–3/−4 RNAi SHSY-5Y cells (Fig. 6a). In MTT assay, we did not observe that the protective effect of MANF in shHSP70–3/−4 RNAi SHSY-5Y cells (Fig. 6b).
Fig. 5

Effects of HSP70 blockade on the protective effects of MANF against 6-OHDA induced apoptosis in SHSY-5Y cells. a SHSY-5Y cells were pretreated with control RNAi of HSP70 for 48 h and then stimulated with 150 μM 6-OHDA or 150 μM 6-OHDA + 4 μg/mL MANF for further 48 h. Cell viability was measured by MTT. (*p < 0.05; one-way ANOVA with Bonferroni post-tests). b Representative fluorescent images for DAPI and TUNEL merged images in control group HSP70 RNAi SHSY-5Y cells; HSP70 RNAi SHSY-5Y cells treated with 150 μM 6-OHDA; HSP70 RNAi SHSY-5Y cells treated with 150 μM 6-OHDA +4 μg/mL MANF; scale bar, 100 μm. c The protective effect of MANF against 6-OHDA-induced apoptosis disappeared in HSP70 RNAi SHSH-5Y cells

Fig. 6

Effects of shHSP70–3/−4 blockade on the protective effects of MANF against 6-OHDA induced apoptosis in SHSY-5Y cells. a, b SHSY-5Y cells were pretreated with control RNAi of shHSP70–3/−4 for 48 h and then stimulated with 50 μM 6-OHDA or 50 μM 6-OHDA + 4 μg/mL MANF for further 48 h. Cell viability was measured by TUNEL and MTT. c A representative Western blot result shows the expression of cleaved caspase-3 in control SHSY-5Y cells, SHSY-5Y cells treated with 150 μM 6-OHDA +4 μg/mL of MANF; 150 μM of 6-OHDA; A representative Western blot result shows the expression of cleaved caspase-3 in HSP70–3/−4RNAi SHSY-5Y cells treated with 150 μM 6-OHDA +4 μg/mL of MANF and 150 μM of 6-OHDA. (*p < 0.05; one-way ANOVA with Bonferroni post-tests)

Discussion

Recently, MANF has been recognized as an important factor that protect dopaminergic neurons in the substantia nigra from injury induced by several toxins [13]. In this study, we found that MANF inhibited 6-OHDA-induced apoptosis in SHSY-5Y cells. 6-OHDA is a neurotoxin widely used to create animal models of PD. In the experiment, the expression of TUNEL staining was observed by immunohistochemical staining to determine the number of apoptotic cells. We found that 6-OHDA increased the positive TUNEL staining, a marker of apoptosis. MANF treatment inhibited the increase of TUNEL staining induced by 6-OHDA. Our findings are consistent with recent studies, showing that MANF inhibits ER stress relative apoptosis [14]. That means, the protective effect of MANF were due to ER stress relative apoptosis suppression.

Our present understanding of the neuron protection mechanism of MANF suggests that it is involved in the regulation of ER stress and unfolded protein response (UPR) [3, 15]. In our study, expression of two ER stress marker genes, HSP70 and GRP78 were up-regulated under MANF + 6-OHDA treatment. This is in parallel with previous studies which showed that MANF reduces ER stress and inhibits ER stress-induced neuronal apoptosis [16]. We identified that MANF treatment significantly up-regulated HSP70 levels in SHSY-5Y cell models, which was accompanied by a decrease in cleaved caspase-3 level, suggesting that MANF alleviates ER-induced apoptosis through HSP70 up-regulation. Lee et al. demonstrated that MANF was an ER stress-responsive gene. MANF mRNA and protein were induced on ATF6 activation in the myocardium, in vivo, consistent with the hypothesis that ER stresses, such as ischemia, which can activate ATF6, a hallmark of ER stress genes, might also induce MANF expression in the heart [17, 18]. Rescently, it has been reported that lack of MANF in vivo in mouse leads to chronic activation of UPR [3]. ER stress and chronic activation of UPR play an important role in the pathogenesis of PD [19]. Thus, MANF has significant potential as a treatment of PD.

In a whole-genome microarray and pathway analysis, the expression of genes involved in membrane transport and the ER stress was found to be altered, in the absence of MANF, in drosophilaa models [20]. In parallel with this study, our RNA-seq result revealed that many of the genes up-regulated in MANF treatment group were associated with biological processes/pathways related to stimulus response. In ER stress relative genes, HSP70 and Grp78 changed significantly. Combined with our previous work, we found they were both involved in a survival signal transduction. Jessie S et al. showed that after a transient ischemic insult, the subcellular responses to the accumulation of unfolded proteins varies between cellular compartments and are most prevalent in the cytoplasm and, to a lesser degree, in the mitochondrial matrix and ER lumen. Induction of mRNA for HSP70 occurred earlier (beginning at 30 min) and more moderate (4-24 h) induction of mRNAs for ER lumen Grp78 [21]. Grp78 up-regulation is associated with HSP70-HSP90 client proteins [22]. Cellular events can trigger the unfolded protein response (UPR) and activate the expression of a number of genes involved in pro-survival pathways. Whether the HSP70 and Grp78 participate in a same signal cascade or belong to individual signaling pathways still needs to be investigated. However, aside from HSP70, no other anti-protein misfolding genes were differentially expressed in 6-OHDA + MANF treatment group, suggesting that up-regulation of HSP70 could be responsible for the protective effects of MANF in pathogenic condition of PD. Our Real time-PCR result could further show an increase in HSP70 levels in SHSY-5Y cells under MANF treatment. Similarly, in this study, we found that HSP70 knockdown inhibited the decrease in active caspase-3 levels induced by 6-OHDA, suggesting that HSP70 up-regulation may protect cells from 6-OHDA-induced apoptosis.

Various lines of evidence indicate that HSP70 siRNA transfection can further induce cell death in neuronal cells exposed to 6-OHDA [23, 24]. In our study, we showed that RNAi knockdown for HSP70 could block the protection of MANF against 6-OHDA induced apoptosis. In this research, we also observed that 6-OHDA treatment leads to suppression of HSP70 in SHSY-5Y cells. This result is on the contrary to the evidence in PC12 cells, in which 6-OHDA up-regulates the expression of HSP70. This may be due to PC12 cells and SHSY-5Y cells derived from different organs [23, 24].

HSP70 is a member of heat shock protein family, and it plays a critical function in the rescue of misfolded proteins [2527]. HSP70-related anti-fibrillation may have contributed to the protection of dopaminergic neurons in MANF-treated cells and PD animals [28]. Earlier studies have shown that the aggregation ofα-Synuclein is linked to the pathogenesis of PD. Indeed, α-Syn is the major component of Lewy bodies. Molecular chaperones, which could modulate the pathological conversion of misfolded proteins into cytotoxic species, are recognized as key players in the avoidance of misfolding proteins [2931]. The family of stress-inducible 70KDa heat-shock proteins (HSP70s), plays a critical function in the rescue of misfolded proteins [2527], hence avoiding the potentially harmful effects of the aggregation of the species. Meanwhile, some studies showed that the expression of HSP70 was highly perturbed in the substantia nigra of PD patients, which was the site of neurodegeneration in this condition [3234]. And in our H2O2, TG and TM system, the relationship between MANF and HSP70 was not observed. That means MANF/HSP70 was specific to 6-OHDA induced apoptosis. TM is a bacterial toxin that inhibits N-linked glycosylation of nascent proteins resulting in activation of UPR in mammalian cells [35]. TG has the ability to activate extracellular-signal regulated kinase (ERK), but tunicamycin does not [36]. It is well known that thapsigargin induces ER stress by blocking sarco-endoplasmic reticulum Ca2+-ATPase [36]. H2O2 is a representative ROS that is generated from nearly all sources of oxidative stress and can diffuse freely in and out of tissues [37]. The cytotoxic mechanisms are different between 6-OHDA and tunicamycin. 6-OHDA increases and accumulates reactive oxygen species (ROS) to induce ER stress; however, tunicamycin blocks N-linked glycosylation, accumulating unfolded proteins that induce ER stress [38]. This may explain MANF/HSP70 was specific to 6-OHDA.

Conclusions

Our study indicates that MANF exerts a protective role against in vitro induced apoptosis in SHSY-5Y cells. This function may involve the activation of apoptosis inhibition. The regulation of HSP70 expression contributes to MANF-mediated neuroprotection. It is crucial to highlight and further characterize disease-related differences in basal and inducible gene expression levels. Further studies need to specifically define potential disease-related alterations in the reactivity to MANF and further define which molecular pathway is involved. Our results support the potential of MANF to contribute to a more protective environment for degenerating dopaminergic neurons in PD via regulation of HSP70 and cytokine secretion and therefore to be further evaluated as novel therapeutic approach for the treatment of PD.

Abbreviations

6-OHDA: 

6-hydroxydopamine

ER: 

Endoplasmic reticulum

HSP70: 

Heat shock protein

MANF: 

Mesencephalic astrocyte-derived neurotrophic factor

PD: 

Parkinson’s disease

Declarations

Acknowledgments

Not applicable.

Funding

This study is supported by the National Major Scientific and Technological Special Project for Significant New Drugs Development (2014ZX09102043–003), National Natural Science Foundation of China (81371403), Shanghai Science and Technology Commission (13JC1401102), and Natural Science Foundation of Jiangsu Province of China (BK20140275).

Availability of data and materials

Data sharing not applicable to this article as no datasets were generated or analysed during the current study.

Authors’ contributions

HS and MJ conceived and designed the experiments; QC, JZ, YY, JG, LY and YJ performed the experiments; YL and LF analyzed the data; ZN and JF contributed discussion; HS wrote the paper; LJ contributed guidance on the manuscript. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

Not applicable.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Neurology, Shanghai Tongji Hospital, Tongji University School of Medicine
(2)
School of Life Science and Technology, Tongji University
(3)
Biomedical Research Center, Tongji University Suzhou Institute

References

  1. Petrova P, Raibekas A, Pevsner J, Vigo N, Anafi M, Moore MK, Peaire AE, Shridhar V, Smith DI, Kelly J, et al. MANF: a new mesencephalic, astrocyte-derived neurotrophic factor with selectivity for dopaminergic neurons. J Mol Neurosci. 2003;20(2):173–88.View ArticlePubMedGoogle Scholar
  2. Lindahl M, Saarma M, Lindholm P. Unconventional neurotrophic factors CDNF and MANF: Structure, physiological functions and therapeutic potential. Neurobiol Dis. 2017 97(Pt B):90–102.Google Scholar
  3. Lindahl M, Danilova T, Palm E, Lindholm P, Voikar V, Hakonen E, Ustinov J, Andressoo JO, Harvey BK, Otonkoski T, et al. MANF is indispensable for the proliferation and survival of pancreatic beta cells. Cell Rep. 2014;7(2):366–75.View ArticlePubMedGoogle Scholar
  4. Wei SG, Yu Y, Weiss RM, Felder RB. Endoplasmic reticulum stress increases brain MAPK signaling, inflammation and renin-angiotensin system activity and sympathetic nerve activity in heart failure. Am J Physiol Heart Circ Physiol. 2016;311(4):H871–H880.Google Scholar
  5. Jeong K, Oh Y, Kim S-J, Kim H, Park K-C, Kim SS, Ha J, Kang I, Choe W. Apelin is transcriptionally regulated by ER stress-induced ATF4 expression via a p38 MAPK-dependent pathway. Apoptosis. 2014;19(9):1399–410.View ArticlePubMedGoogle Scholar
  6. Cubillos-Ruiz JR, Silberman PC, Rutkowski MR, Chopra S, Perales-Puchalt A, Song M, Zhang S, Bettigole SE, Gupta D, Holcomb K, et al. ER stress sensor XBP1 controls anti-tumor immunity by disrupting Dendritic cell homeostasis. Cell. 2015;161(7):1527–38.View ArticlePubMedPubMed CentralGoogle Scholar
  7. Huang J, Chen C, Gu H, Li C, Fu X, Jiang M, Sun H, Xu J, Fang J, Jin L. Mesencephalic astrocyte-derived neurotrophic factor reduces cell apoptosis via upregulating GRP78 in SH-SY5Y cells. Cell Biol Int. 2016;40(7):803–11.View ArticlePubMedGoogle Scholar
  8. Alani B, Salehi R, Sadeghi P, Khodagholi F, Digaleh H, Jabbarzadeh-Tabrizi S, Zare M, Korbekandi H. Silencing of Hsp70 intensifies 6-OHDA-induced apoptosis and Hsp90 Upregulation in PC12 cells. J Mol Neurosci. 2015;55(1):174–83.View ArticlePubMedGoogle Scholar
  9. Ortiz C, Cardemil L. Heat-shock responses in two leguminous plants: a comparative study. J Exp Bot. 2001;52(361):1711–9.PubMedGoogle Scholar
  10. Lee AS. The ER chaperone and signaling regulator GRP78/BiP as a monitor of endoplasmic reticulum stress. Methods. 2005;35(4):373–81.View ArticlePubMedGoogle Scholar
  11. Tai KK, Pham L, Truong DD. Idebenone induces apoptotic cell death in the human dopaminergic neuroblastoma SHSY-5Y cells. Neurotox Res. 2011;20(4):321–8.View ArticlePubMedGoogle Scholar
  12. Trapnell C, Pachter L, Salzberg SL. TopHat: discovering splice junctions with RNA-Seq. Bioinformatics. 2009;25(9):1105–11.View ArticlePubMedPubMed CentralGoogle Scholar
  13. Nuss JE, Choksi KB, DeFord JH, Papaconstantinou J. Decreased enzyme activities of chaperones PDI and BiP in aged mouse livers. Biochem Biophys Res Commun. 2008;365(2):355–61.View ArticlePubMedGoogle Scholar
  14. Cooper AA, Gitler AD, Cashikar A, Haynes CM, Hill KJ, Bhullar B, Liu K, Xu K, Strathearn KE, Liu F, et al. Alpha-synuclein blocks ER-Golgi traffic and Rab1 rescues neuron loss in Parkinson's models. Science. 2006;313(5785):324–8.View ArticlePubMedPubMed CentralGoogle Scholar
  15. Hellman M, Arumae U, Yu LY, Lindholm P, Peranen J, Saarma M, Permi P. Mesencephalic astrocyte-derived neurotrophic factor (MANF) has a unique mechanism to rescue apoptotic neurons. J Biol Chem. 2011;286(4):2675–80.View ArticlePubMedGoogle Scholar
  16. Arrieta A, Blackwood EA, Stauffer WT, Pentoney AN, Thuerauf DJ, Doroudgar S, Glembotski CC. Abstract 19772: MANF, a structurally unique ER stress-inducible protein, restores ER-protein folding in ER stressed cardiac Myocytes and in the ischemic heart. Circulation. 2016;134(Suppl_1 Suppl 1):A19772.Google Scholar
  17. Tadimalla A, Belmont PJ, Thuerauf DJ, Glassy MS, Martindale JJ, Gude N, Sussman MA, Glembotski CC. Mesencephalic Astrocyte-derived Neurotrophic factor is an ischemia-inducible secreted endoplasmic reticulum stress response protein in the heart. Circ Res. 2008;103(11):1249–58.View ArticlePubMedPubMed CentralGoogle Scholar
  18. Lee A-H, Iwakoshi NN, Glimcher LH. XBP-1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. Mol Cell Biol. 2003;23(21):7448–59.View ArticlePubMedPubMed CentralGoogle Scholar
  19. Nuss JE, Choksi KB, DeFord JH, Papaconstantinou J. Decreased enzyme activities of chaperones PD1 and BiP in aged mouse livers. Biochem Biophys Res Commun. 2008;365(2):355–61.View ArticlePubMedGoogle Scholar
  20. Palgi M, Greco D, Lindstrom R, Auvinen P, Heino TI. Gene expression analysis of Drosophilaa Manf mutants reveals perturbations in membrane traffic and major metabolic changes. BMC Genomics. 2012;13:134.View ArticlePubMedPubMed CentralGoogle Scholar
  21. Truettner JS, Hu B, Hu K, Liu CL, Dietrich WD. Subcellular stress response and induction of molecular chaperones and folding proteins after transient global ischemia in rats. Brain Res. 2009;1249:9–18.View ArticlePubMedGoogle Scholar
  22. Tan SS, Ahmad I, Bennett HL, Singh L, Nixon C, Seywright M, Barnetson RJ, Edwards J, Leung HY. GRP78 up-regulation is associated with androgen receptor status, Hsp70–Hsp90 client proteins and castrate-resistant prostate cancer. J Pathol. 2011;223(1):81–7.View ArticlePubMedGoogle Scholar
  23. Alani B, Salehi R, Sadeghi P, Khodagholi F, Digaleh H, Jabbarzadeh-Tabrizi S, Zare M, Korbekandi H. Silencing of Hsp70 intensifies 6-OHDA-induced apoptosis and Hsp90 upregulation in PC12 cells. J.Mol Neurosci. 2015;55(1):174–83.View ArticlePubMedGoogle Scholar
  24. Alani B, Salehi R, Sadeghi P, Zare M, Khodagholi F, Arefian E, Hakemi MG, Digaleh H. Silencing of Hsp90 chaperone expression protects against 6-hydroxydopamine toxicity in PC12 cells. J.Mol Neurosci. 2014;52(3):392–402.View ArticlePubMedGoogle Scholar
  25. Gragerov A, Nudler E, Komissarova N, Gaitanaris GA, Gottesman ME, Nikiforov V. Cooperation of GroEL/GroES and DnaK/DnaJ heat shock proteins in preventing protein misfolding in Escherichia coli. Proc Natl Acad Sci U S A. 1992;89(21):10341–4.View ArticlePubMedPubMed CentralGoogle Scholar
  26. Martinez-Alonso M, Gomez-Sebastian S, Escribano JM, Saiz JC, Ferrer-Miralles N, Villaverde A. DnaK/DnaJ-assisted recombinant protein production in Trichoplusia ni larvae. Appl Microbiol Biotechnol. 2010;86(2):633–9.View ArticlePubMedGoogle Scholar
  27. Kedzierska S, Jezierski G, Taylor A. DnaK/DnaJ chaperone system reactivates endogenous E. coli thermostable FBP aldolase in vivo and in vitro; the effect is enhanced by GroE heat shock proteins. Cell Stress Chaperones. 2001;6(1):29–37.View ArticlePubMedPubMed CentralGoogle Scholar
  28. Pastukhov YF, Plaksina DV, Lapshina KV, Guzhova IV, Ekimova IV. Exogenous protein HSP70 blocks neurodegeneration in the rat model of the clinical stage of Parkinson's disease. Dokl Biol Sci. 2014;457(1):225–7.View ArticlePubMedGoogle Scholar
  29. Dobson CM. Protein folding and misfolding. Nature. 2003;426(6968):884–90.View ArticlePubMedGoogle Scholar
  30. Young JC, Agashe VR, Siegers K, Hartl FU. Pathways of chaperone-mediated protein folding in the cytosol. Nat Rev Mol Cell Biol. 2004;5(10):781–91.View ArticlePubMedGoogle Scholar
  31. Balch WE, Morimoto RI, Dillin A, Kelly JW. Adapting proteostasis for disease intervention. Science. 2008;319(5865):916–9.View ArticlePubMedGoogle Scholar
  32. Mandel S, Grunblatt E, Maor G, Youdim MB. Early and late gene changes in MPTP mice model of Parkinson's disease employing cDNA microarray. Neurochem Res. 2002;27(10):1231–43.View ArticlePubMedGoogle Scholar
  33. Hauser MA, Li YJ, Xu H, Noureddine MA, Shao YS, Gullans SR, Scherzer CR, Jensen RV, McLaurin AC, Gibson JR, et al. Expression profiling of substantia nigra in Parkinson disease, progressive supranuclear palsy, and frontotemporal dementia with parkinsonism. Arch Neurol. 2005;62(6):917–21.View ArticlePubMedGoogle Scholar
  34. Moran LB, Duke DC, Deprez M, Dexter DT, Pearce RK, Graeber MB. Whole genome expression profiling of the medial and lateral substantia nigra in Parkinson's disease. Neurogenetics. 2006;7(1):1–11.View ArticlePubMedGoogle Scholar
  35. Bull VH, Thiede B. Proteome analysis of tunicamycin-induced ER stress. Electrophoresis. 2012;33(12):1814–23.View ArticlePubMedGoogle Scholar
  36. Kamiya T, Obara A, Hara H, Inagaki N, Adachi T. ER stress inducer, thapsigargin, decreases extracellular-superoxide dismutase through MEK/ERK signalling cascades in COS7 cells. Free Radic Res. 2011;45(6):692–8.View ArticlePubMedGoogle Scholar
  37. Min S-K, Lee S-K, Park J-S, Lee J, Paeng J-Y, Lee S-I, Lee H-J, Kim Y, Pae H-O, Lee S-K, et al. Endoplasmic reticulum stress is involved in hydrogen peroxide induced apoptosis in immortalized and malignant human oral keratinocytes: H2O2 induced ER stress apoptosis in oral cancer cells. J Oral Pathol Med. 2008;37(8):490–8.View ArticlePubMedGoogle Scholar
  38. Luo F, Wei L, Sun C, Chen X, Wang T, Li Y, Liu Z, Chen Z, Xu P. HtrA2/Omi is involved in 6-OHDA-induced endoplasmic reticulum stress in SH-SY5Y cells. J Mol Neurosci. 2012;47(1):120–7.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s). 2017

Advertisement