Skip to main content

Table 1 Primers for qPCR

From: Dynamic changes of CX3CL1/CX3CR1 axis during microglial activation and motor neuron loss in the spinal cord of ALS mouse model

Primer Forward primer Reverse primer
GAPDH TGTGTCCGTCGTGGATCTGA TTGCTGTTGAAGTCGCAGGAG
CD206 TCAGCTATTGGACGCGAGGCA TCCGGGTTGCAAGTTGCCGT
CD86 ACGATGGACCCCAGATGCACCA GCGTCTCCACGGAAACAGCA
INOS CCCTCCTGATCTTGTGTTGGA CAACCCGAGCTCCTGGAA
IL-1β TGCCACCTTTTGACAGTGATG ATGTGCTGCTGCGAGAATTTG
TNF-α CCAGTGTGGGAAGCTGTCTT AAGCAAAAGAGGAGGCAACA
Arg1 CTTGCGAGACGTAGACCCTG TCCATCACCTTGCCAATCCC
CX3CR1 CTGTTATTTGGGCGACATTG AACAGATTTCCCACCAGACC
CX3CL1 ATTGGAAGACCTTGCTTTGG GCCTCGGAAGTTGAGAGAGA
IL-10 GGCAGAGAAGCATGGCCCAGAA AATCGATGACAGCGCCTCAGCC