Skip to main content

Table 1 Primer sequences for amplifying full length KGA, full length GAC and all the deletions

From: Serial deletion reveals structural basis and stability for the core enzyme activity of human glutaminase 1 isoforms: relevance to excitotoxic neurodegeneration

KGA
1AA - 669AA
Forward: AGGATCCATGCGGCTGCGAGGCTCGGGGATGCTG
Reverse: GCTCGAGTTACAACAATCCATCAAG
KGA
111AA - 669AA
Forward: TGGATCCATGGAGACGGACGCGTTTGGCAAC
Reverse: GCTCGAGTTACAACAATCCATCAAG
KGA
219AA - 669AA
Forward: CGGATCCATGGTGATTCCTGACTTTATGTC
Reverse: GCTCGAGTTACAACAATCCATCAAG
KGA
311AA - 669AA
Forward: TGGATCCATGGAGCCGAGTGGACTAAGATTC
Reverse: GCTCGAGTTACAACAATCCATCAAG
KGA
415AA - 669AA
Forward: TGGATCCATGCAGCTGTGCTCCATTGAAGTG
Reverse: GCTCGAGTTACAACAATCCATCAAG
GAC
1AA - 598AA
Forward: AGGATCCATGCGGCTGCGAGGCTCGGGGATGCTG
Reverse: GCTCGAGTTAGCTTTTCTCTCCCAGAC
GAC
111AA - 598AA
Forward: CCTCGAGTCCTTCAGCAATTGTATAG
Reverse: GCTCGAGTTAGCTTTTCTCTCCCAGAC
GAC
219AA - 598AA
Forward: CGGATCCATGGTGATTCCTGACTTTATGTC
Reverse: GCTCGAGTTAGCTTTTCTCTCCCAGAC
GAC
311AA - 598AA
Forward: TGGATCCATGGAGCCGAGTGGACTAAGATTC
Reverse: GCTCGAGTTAGCTTTTCTCTCCCAGAC
GAC
415AA - 598AA
Forward: TGGATCCATGCAGCTGTGCTCCATTGAAGTG
Reverse: GCTCGAGTTAGCTTTTCTCTCCCAGAC
GLS1
1AA - 550AA
Forward: AGGATCCATGCGGCTGCGAGGCTCGGGGATGCTG
Reverse: GCTCGAGCCTTTGATCACCACCTTCTC
GLS1
1AA - 450AA
Forward: AGGATCCATGCGGCTGCGAGGCTCGGGGATGCTG
Reverse: GCTCGAGAGGGCTCAGTACTCTTTCACCA
GLS1
1AA - 344AA
Forward: AGGATCCATGCGGCTGCGAGGCTCGGGGATGCTG
Reverse: GCTCGAGTAGTGAAGTCACAACAATTGC
GLS1
1AA - 247AA
Forward: AGGATCCATGCGGCTGCGAGGCTCGGGGATGCTG
Reverse: GCTCGAGTGCAACCTTTCCTCCAGACT
GLS1
1AA - 150AA
Forward: AGGATCCATGCGGCTGCGAGGCTCGGGGATGCTG
Reverse: CCTCGAGTCCTTCAGCAATTGTATAG
GLS1
219AA - 550AA
Forward: CGGATCCATGGTGATTCCTGACTTTATGTC
Reverse: GCTCGAGCCTTTGATCACCACCTTCTC