Skip to main content

Table 1 List of potentially disease-causative, heterozygous variants based on whole-exome sequencing indicating gene (Gene), reference sequence (RefSeq), mutation within the gene sequence (MutCDNA), position of the mutation within the genome according to hg38 (Position), mutation within the protein sequence (MutProt), type of mutation (Type), chromosome location (Chr), allele frequency (AL), number of affected exon (MutPos) and consequence of mutation (Consequence)

From: Stroke-like onset of brain stem degeneration presents with unique MRI sign and heterozygous NMNAT2 variant: a case report

Gene RefSeq MutCDNA Position MutProt Type Chr AF MutPos Consequence
HIST1H2AG NM_021064.4 c.1A > G 27100851 p.M1V SNP 6 het CDS.1 Start codon lost
KAT5 NM_001206833.1 c.164A > G 65479902 p.N55S SNP 11 het CDS.1 Non-synonymous coding
LGR5 NM_003667.2 c.2611_2613del(T)3ins(T)2 71978401 p.F871Lfs*22 INDEL 12 het CDS.18 Frameshift
LIMCH1 NM_001112719.1 c.20_21insG 41615112 p.K8Qfs*4 INS 4 het CDS.1 Frameshift
LPPR3 NM_024888.1 c.1579G > A 813232 p.E527K SNP 19 het CDS.7 Frameshift
MFF NM_020194.4 c.696delG 228212044 p.Q232Hfs*46 DEL 2 het CDS.8 Frameshift
MLNR NM_001507.1 c.762_764delCTA 49795235 p.Y255del DEL 13 het CDS.1 Deletion
MYH7B NM_020884.3 c.3425_3428delGGGTins (GGGT)2 33584918 p.E1144Gfs*130 INDEL 20 het CDS.29 Frameshift
NMNAT2 NM_170706.3 c.482 T > C 183253877 p.V161A SNP 1 het CDS.6 Non-synonymous coding
PRDM16 NM_199454.2 c.1093G > C 3322119 p.A365P SNP 1 het CDS.8 Non-synonymous coding
STOX1 NM_152709.4 c.2341G > T 70645893 p.E781* SNP 10 het CDS.3 Stop codon gained
TRIM41 NM_201627.2 c.424_447delGAGGAGGACCTGAGGGGGGAGGAT 180651423 p.E142_D149del DEL 5 het CDS.1 Deletion