Skip to main content

Table 1 Primers for PCR assays

From: Methylation status of DJ-1 in leukocyte DNA of Parkinson’s disease patients

Primer Sequence (5’ > 3’) Tm (°C) Amplicon (bp)
DJ-1- CpG1-methylation-PCR-F GTTYGGGAGGTTTGGATTAGAGTT 56 170
DJ-1- CpG1-methylation-PCR-R ACRACTCRATCCCACATAATACCC   
DJ-1- CpG2-methylation-PCR-F TTGYGTAGTGTGGGGTTGAGG 58 141
DJ-1- CpG2-methylation-PCR-R ACCRTCCAACACAAAAACACC   
DJ-1- CpG1-methylation-Seq-R ACRACTCRATCCCACATAATACCC   
DJ-1- CpG2-methylation-Seq-R ACCRTCCAACACAAAAACACC   
DJ-1- Realtime-F CGGGGTGCAGGCTTGTAAA 58 150
DJ-1- Realtime-R TCCGGTTTTCCTGCTCCTTC