Open Access

Stroke-like onset of brain stem degeneration presents with unique MRI sign and heterozygous NMNAT2 variant: a case report

  • Alexander Schulz1, 2,
  • Franziska Wagner1Email author,
  • Martin Ungelenk3,
  • Ingo Kurth3, 4 and
  • Christoph Redecker1
Contributed equally
Translational Neurodegeneration20165:23

DOI: 10.1186/s40035-016-0069-x

Received: 24 August 2016

Accepted: 2 December 2016

Published: 27 December 2016

Abstract

Background

Acute-onset neurodegenerative diseases in older patients are rare clinical cases, especially when the degeneration only affects specific regions of the nervous system. Several neurological disorders have been described in which the degeneration of brain parenchyma originates from and/or primarily affects the brain stem. Clinical diagnosis in these patients, however, is often complicated due to a poor understanding of these diseases and their underlying mechanisms.

Case presentation

In this manuscript we report on a 73-year-old female who had experienced a sudden onset of complex neurological symptoms that progressively worsened over a period of 2 years. Original evaluation had suggested a MRI-negative stroke as underlying pathogenesis. The combination of patient’s medical history, clinical examination and exceptional pattern of brain stem degeneration presenting as “kissing swan sign” in MR imaging was strongly suggestive of acute onset of Alexander’s disease. This leukoencephalopathy is caused by GFAP (glial fibrilary acidic protein) gene mutations and may present with brain stem atrophy and stroke-like onset of symptoms in elderly individuals. However, a pathognomonic GFAP gene mutation could not be identified by Sanger sequencing.

Conclusions

After an extended differential diagnosis and exclusion of other diseases, a definite diagnosis of the patient’s condition presently remains elusive. However, whole-exome sequencing performed from patient’s blood revealed 12 potentially disease-causative heterozygous variants, amongst which several have been associated with neurological disorders in vitro and in vivo – in particular the axon degeneration-related NMNAT2 gene.

Keywords

Brain stem atrophy Dementia Alexander’s disease Whole-exome sequencing Kissing swan sign NMNAT2 Axon degeneration

Background

Neurodegenerative diseases can selectively target subpopulations of neurons in the CNS, leading to the progressive failure of defin22ed brain systems with consecutive disease-specific clinical features [1]. In various known neurological disorders, the degeneration of brain parenchyma originates from and/or primarily affects the brain stem, such as in olivopontocerebellar atrophy (OPCA), progressive supranuclear palsy (PSP), several spinocerebellar ataxia (SCA) types and various entities of leukodystrophies [24]. Most of these disorders have been directly or indirectly linked to specific gene mutations.

Even for long-lasting progressive neurodegenerative diseases, it has been shown that the actual cell death of neurons occurs rapidly over several hours [5]. Importantly, genetic mutations known to provoke specific neurodegenerative disorders often accelerate the very same molecular cascades that occur in late-onset types of the same diseases where those mutations cannot be found (with a classical example being Parkinson’s disease).

Case presentation

A 73-year-old woman presented with a two-year history of progressive memory loss, urinary incontinence and walking difficulties. She had presented to an outside facility two years prior with acute onset of symptoms including a fall event. At the time of her initial presentation, she was diagnosed and reported as having had a stroke with negative findings in native CT, CT angiography and CT perfusion, as well as brain MR imaging (“MRI-negative stroke”) [6]. Clinical examination of the patient at our clinic now revealed a spastic-ataxic gait with positive pyramid signs and Romberg’s test, scanning speech, disturbed fine motor skills and dysmetria of all extremities.

Neuropsychological investigation found memory deficits suggestive of cortical dementia. Cerebrospinal fluid analysis, however, was normal with regard to both dementia and tissue destruction markers (Aβ42, total tau and phospho tau). Neither orthostatic nor autonomic dysfunction could not be detected. The possibility of a paraneoplastic syndrome was addressed by performing extensive screening for malignant tumors and known autoantibodies using imaging and serological evaluation.

Strikingly, brain MR imaging revealed a general atrophy of brain parenchyma with remarkable emphasis on the brain stem region (Fig. 1a and b). Here, a manifest gliotic neurodegeneration in the medulla oblongata with predominant loss of pyramidal tracts presented as “tadpole” appearance – a radiological sign exclusively described in association with Alexander’s disease [7] (Fig. 1a). Even more prominently, pattern of brain stem degeneration resembled “kissing swans” in coronal sections (Fig. 1c). Importantly, no contrast enhancement could be observed in the brain stem or any other part of the brain following Gadolinium administration (Fig. 1d), indicating blood-brain barrier integrity. Furthermore, a marked atrophy of the upper cervical spinal cord was detected (Fig. 1e).
https://static-content.springer.com/image/art%3A10.1186%2Fs40035-016-0069-x/MediaObjects/40035_2016_69_Fig1_HTML.gif
Fig. 1

Brain stem degeneration presents in brain MRI. Sagittal (a) and transversal (b) T2-weighted brain MRI indicates gliotic neurodegeneration in the medulla oblongata with predominant loss of pyramidal tracts. Magnification of inlay (c) uncovers pathologic brain stem formation reminiscent of ‘kissing swans’. d Transversal T1-weighted sectioning of the brain stem (arrow) after Gadolinium administration. No contrast enhancement is detectable. e Sagittal T2-weighted cervical spine MRI shows atrophy of the upper cervical spinal cord in addition to medulla oblongata atrophy. f Transversal T2-weighted brain MRI indicates putative periventricular rim-sign and global brain atrophy. g Brain MRI-angiography reveals normal intracranial vascular status without indication of stenosis

DaTscan/IBZM SPECT and FDG-PET results were neither indicative of idiopathic nor atypical Parkinson’s disease (not shown).

The combination of patient history and characteristic brain stem degeneration was strongly reminiscent of case reports of acute-onset adult Alexander’s disease (AOAD) [8]. Alexander’s disease is a rare form of leukodystrophy, characterized by white matter degeneration, mainly caused by gain-of-function mutations of the glial fibrillary acidic protein (GFAP) in astrocytes [9].

Although most cases were reported to occur sporadically, autosomal dominant transmissions have been described [10]. The family history of this patient was devoid of similar cases, with the important limitation that the patient had been adopted along with her siblings and has no children herself. However, personal reports as well as brain MR imaging findings of the patient’s sister, niece and grandniece gave no indication of a comparable disease in the patient’s family.

In order to genetically examine the suspected diagnosis of Alexander’s disease, we performed Sanger sequencing of all coding exons and adjacent intronic regions of the GFAP gene from the patient’s blood. Strikingly, we could not identify any mutations in the GFAP gene. Specific genetic testing for the most frequent spinocerebellar ataxia (SCA) types [11] was also negative.

We therefore performed whole-exome sequencing from patient’s blood, which provides an unbiased analysis of all protein-coding sequences in the human genome. Stringent filtering of whole-exome sequencing data for rare genetic variants (using dbSNP, 1000 genomes project, the Exome Variant Server and ExAC browser) as well as for disease-causative variants (using SIFT, Polyphen 2 and Mutation taster 2) resulted in a list of 12 potentially disease-causative heterozygous variants (Table 1).
Table 1

List of potentially disease-causative, heterozygous variants based on whole-exome sequencing indicating gene (Gene), reference sequence (RefSeq), mutation within the gene sequence (MutCDNA), position of the mutation within the genome according to hg38 (Position), mutation within the protein sequence (MutProt), type of mutation (Type), chromosome location (Chr), allele frequency (AL), number of affected exon (MutPos) and consequence of mutation (Consequence)

Gene

RefSeq

MutCDNA

Position

MutProt

Type

Chr

AF

MutPos

Consequence

HIST1H2AG

NM_021064.4

c.1A > G

27100851

p.M1V

SNP

6

het

CDS.1

Start codon lost

KAT5

NM_001206833.1

c.164A > G

65479902

p.N55S

SNP

11

het

CDS.1

Non-synonymous coding

LGR5

NM_003667.2

c.2611_2613del(T)3ins(T)2

71978401

p.F871Lfs*22

INDEL

12

het

CDS.18

Frameshift

LIMCH1

NM_001112719.1

c.20_21insG

41615112

p.K8Qfs*4

INS

4

het

CDS.1

Frameshift

LPPR3

NM_024888.1

c.1579G > A

813232

p.E527K

SNP

19

het

CDS.7

Frameshift

MFF

NM_020194.4

c.696delG

228212044

p.Q232Hfs*46

DEL

2

het

CDS.8

Frameshift

MLNR

NM_001507.1

c.762_764delCTA

49795235

p.Y255del

DEL

13

het

CDS.1

Deletion

MYH7B

NM_020884.3

c.3425_3428delGGGTins (GGGT)2

33584918

p.E1144Gfs*130

INDEL

20

het

CDS.29

Frameshift

NMNAT2

NM_170706.3

c.482 T > C

183253877

p.V161A

SNP

1

het

CDS.6

Non-synonymous coding

PRDM16

NM_199454.2

c.1093G > C

3322119

p.A365P

SNP

1

het

CDS.8

Non-synonymous coding

STOX1

NM_152709.4

c.2341G > T

70645893

p.E781*

SNP

10

het

CDS.3

Stop codon gained

TRIM41

NM_201627.2

c.424_447delGAGGAGGACCTGAGGGGGGAGGAT

180651423

p.E142_D149del

DEL

5

het

CDS.1

Deletion

The most notable of these candidate genes was NMNAT2, which encodes for one isoform of the nicotinamide mononucleotide adenylyltransferases. Its neuroprotective role in numerous preclinical models of neurodegeneration is well established. Experimental deletion of NMNAT2 function increases the vulnerability of CNS neurons and accelerates Wallerian degeneration [12]. Furthermore, NMNAT2 transcript levels have been shown to negatively correlate with neurodegeneration in a large study of 541 human individuals [13]. Importantly, deletion of a single NMNAT2 allele, analogous to the heterozygous variant found in the presented patient, was sufficient to induce neurite degeneration in primary neuronal cultures [14].

Another candidate gene, STOX1 has been associated with phosphorylation of tau proteins in late-onset Alzheimer’s disease [15]. KAT5, in addition, acts as a nuclear hormone receptor coactivator and has been linked to spinocerebellar ataxia type 1 [16].

Discussion

Acute onset of chronic neurodegenerative diseases such as dementia [17] or movement disorders [18] in elderly individuals can occur as a result of various pathological conditions. However, the mechanisms determining an acute disease course as opposed to a slowly-progressive one for a specific disease are incompletely understood. For these and other reasons, both the definite diagnosis and the underlying cause of the presented patient’s condition are yet unknown. The diagnosis of adult-onset Alexander’s disease (AOAD) as a rare leukoencephalopathy disorder predominantly affecting the brain stem and having stroke-like onset of symptoms [8] has to be excluded in this patient’s case, due to the apparent absence of a detectable GFAP gene mutation; nevertheless, the unique combination of clinical presentation, patient history and severe degeneration of the medulla oblongata are consistent with other reports on the disease.

It therefore needs to be resolved in future studies whether Alexander’s disease can be caused by mutations in genes other than GFAP, or whether mutations in other genes can lead to comparable but independent disease entities. In fact, phenotypically comparable presentations of adult onset ataxia, dementia, and typical MRI findings (tadpole sign) have been described in GFAP mutation-negative patients [19].

Remarkably, the original diagnosis in this case (2 years prior to the current examination) was MR-negative stroke, thereby addressing the sudden onset of symptoms. Yet, in the current follow-up evaluation, no vascular pathologies (Fig. 1f and g) or cardiovascular risk factors (diabetes mellitus, cardiac arrhythmia, smoking, hyperlipidemia) except for mild hypertension could be determined. Furthermore, several of the initial symptoms (spasticity and memory loss in particular) were reported to be steadily progressive by the patient.

Other possible differential diagnoses as underlying cause for the patient’s condition (multiple system atrophy, progressive supranuclear palsy, spinocerebellar ataxia or paraneoplastic/immunological syndrome etc.) appear unlikely at this time, based on the existing information.

Conclusions

Despite an extended differential diagnosis and exclusion of other possible diseases, a definite diagnosis of the presented case remains elusive. The diagnosis of adult-onset Alexander’s disease predominantly affecting the brain stem with stroke-like onset of symptoms has to be excluded, because of the apparent absence of a detectable GFAP gene mutation. Yet, stringent filtering of whole-exome sequencing data reveals 12 potentially disease-causative heterozygous variants, which may impact the patient’s condition. Additional cases or disease-mimicking animal models with targeted gene knockout or over-expression of candidate genes will be necessary to clarify a disease-causative potential of the candidates shown in Table 1.

However, the identification of several genes with experimentally proven connection to neurodegenerative diseases, in particular the axon degeneration-related gene NMNAT2, as well as the uniqueness of this case suggest a genetic cause for the patient’s debilitating and progressive condition.

Abbreviations

AOAD: 

Adult-onset Alexander’s disease

CNS: 

Central nervous system

DaTscan: 

Dopamine transporter scan

Del: 

Deletion

FDG: 

Fluorodeoxyglucose

GFAP: 

Glial fibrilary acidic protein

IBZM: 

Iodobenzamide

Indel: 

Insertion/Deletion

MRI: 

Magnetic resonance imaging

NMNAT2: 

Nicotinamide nucleotide adenylyltransferase 2

OPCA: 

Olivopontocerebellar atrophy

PET: 

Positron emission tomography

PSP: 

Progressive supranuclear palsy

SCA: 

Spinocerebellar ataxia

SNP: 

Single nucleotide polymorphism

SPECT: 

Single-photon emission computed tomography

STIR: 

Short tau inversion recovery.

Declarations

Acknowledgements

The authors would like to thank their colleagues of the Neuroradiology and Nuclear Medicine department of Jena University Hospital for MRI data acquisition.

Funding

No targeted funding reported.

Availability of data and materials

The genetic dataset and the raw picture material supporting the conclusions of this article are available as figshare-file https://figshare.com/s/982769c67e5631ba4f9d.

The datasets for the IBZM-SPECT, the DATScan and the PET-Study are not published online in interest of the patient’s identity.

Authors’ contributions

AS and FW examined the patient and wrote the manuscript. MV and IK analyzed whole-exome sequencing data and CR provided study supervision. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Written informed consent was obtained from the patient for publication of this Case report and any accompanying images.

Ethics approval and consent to participate

All procedures in this study were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Hans Berger Department of Neurology, Jena University Hospital, Friedrich Schiller University Jena
(2)
Present address: Department of Genetics and Program in Cellular Neuroscience, Neurodegeneration and Repair, Yale University School of Medicine
(3)
Institute of Human Genetics, Jena University Hospital, Friedrich-Schiller-University Jena
(4)
Present address: Institute of Human Genetics, Uniklinik RWTH Aachen

References

  1. Saxena S, Caroni P. Selective neuronal vulnerability in neurodegenerative diseases: from stressor thresholds to degeneration. Neuron. 2011;71(1):35–48.View ArticlePubMedGoogle Scholar
  2. Palacios Bote R, Fernandez-Gil MA. Degeneration of the brainstem. Semin Ultrasound CT MR. 2013;34(2):142–52.View ArticlePubMedGoogle Scholar
  3. Schmitz-Hubsch T, Coudert M, Bauer P, Giunti P, Globas C, Baliko L, Filla A, Mariotti C, Rakowicz M, Charles P, et al. Spinocerebellar ataxia types 1, 2, 3, and 6: disease severity and nonataxia symptoms. Neurology. 2008;71(13):982–9.View ArticlePubMedGoogle Scholar
  4. Ahmed RM, Murphy E, Davagnanam I, Parton M, Schott JM, Mummery CJ, Rohrer JD, Lachmann RH, Houlden H, Fox NC, et al. A practical approach to diagnosing adult onset leukodystrophies. J Neurol Neurosurg Psychiatry. 2014;85(7):770–81.View ArticlePubMedGoogle Scholar
  5. Mattson MP. Apoptosis in neurodegenerative disorders. Nat Rev Mol Cell Biol. 2000;1(2):120–9.View ArticlePubMedGoogle Scholar
  6. Alberts MJ, Faulstich ME, Gray L. Stroke with negative brain magnetic resonance imaging. Stroke. 1992;23(5):663–7.View ArticlePubMedGoogle Scholar
  7. Namekawa M, Takiyama Y, Honda J, Shimazaki H, Sakoe K, Nakano I. Adult-onset Alexander disease with typical “tadpole” brainstem atrophy and unusual bilateral basal ganglia involvement: a case report and review of the literature. BMC Neurol. 2010;10:21.View ArticlePubMedPubMed CentralGoogle Scholar
  8. Schmidt H, Kretzschmar B, Lingor P, Pauli S, Schramm P, Otto M, Ohlenbusch A, Brockmann K. Acute onset of adult Alexander disease. J Neurol Sci. 2013;331(1–2):152–4.View ArticlePubMedGoogle Scholar
  9. Johnson AB, Brenner M. Alexander’s disease: clinical, pathologic, and genetic features. J Child Neurol. 2003;18(9):625–32.View ArticlePubMedGoogle Scholar
  10. Pareyson D, Fancellu R, Mariotti C, Romano S, Salmaggi A, Carella F, Girotti F, Gattellaro G, Carriero MR, Farina L, et al. Adult-onset Alexander disease: a series of eleven unrelated cases with review of the literature. Brain. 2008;131(Pt 9):2321–31.View ArticlePubMedGoogle Scholar
  11. Jacobi H, Hauser TK, Giunti P, Globas C, Bauer P, Schmitz-Hubsch T, Baliko L, Filla A, Mariotti C, Rakowicz M, et al. Spinocerebellar ataxia types 1, 2, 3 and 6: the clinical spectrum of ataxia and morphometric brainstem and cerebellar findings. Cerebellum. 2012;11(1):155–66.View ArticlePubMedGoogle Scholar
  12. Gilley J, Coleman MP. Endogenous Nmnat2 is an essential survival factor for maintenance of healthy axons. PLoS Biol. 2010;8(1):e1000300.View ArticlePubMedPubMed CentralGoogle Scholar
  13. Ali YO, Allen HM, Yu L, Li-Kroeger D, Bakhshizadehmahmoudi D, Hatcher A, McCabe C, Xu J, Bjorklund N, Taglialatela G, et al. NMNAT2:HSP90 Complex Mediates Proteostasis in Proteinopathies. PLoS Biol. 2016;14(6):e1002472.View ArticlePubMedPubMed CentralGoogle Scholar
  14. Gilley J, Adalbert R, Yu G, Coleman MP. Rescue of peripheral and CNS axon defects in mice lacking NMNAT2. J Neurosci. 2013;33(33):13410–24.View ArticlePubMedGoogle Scholar
  15. van Abel D, Abdulhamid O, Scheper W, van Dijk M, Oudejans CB. STOX1A induces phosphorylation of tau proteins at epitopes hyperphosphorylated in Alzheimer’s disease. Neurosci Lett. 2012;528(2):104–9.View ArticlePubMedGoogle Scholar
  16. Serra HG, Duvick L, Zu T, Carlson K, Stevens S, Jorgensen N, Lysholm A, Burright E, Zoghbi HY, Clark HB, et al. RORalpha-mediated Purkinje cell development determines disease severity in adult SCA1 mice. Cell. 2006;127(4):697–708.View ArticlePubMedGoogle Scholar
  17. Geschwind MD, Shu H, Haman A, Sejvar JJ, Miller BL. Rapidly progressive dementia. Ann Neurol. 2008;64(1):97–108.View ArticlePubMedPubMed CentralGoogle Scholar
  18. Dressler D, Benecke R. Diagnosis and management of acute movement disorders. J Neurol. 2005;252(11):1299–306.View ArticlePubMedGoogle Scholar
  19. Ferreira MC, Dorboz I, Rodriguez D, Boespflug Tanguy O. Screening for GFAP rearrangements in a cohort of Alexander disease and undetermined leukoencephalopathy patients. Eur J Med Genet. 2015;58(9):466–70.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s). 2016

Advertisement